Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249110

Morpholino Name: abr MO1
Synonyms: Abr MO
Target mRNA: abr

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGTCTTGGTGGCTGACGGGTTCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 23/25
genome
MO
5' ATGGAACCCGTCAGCCACCAAGACA 3'
   |||||||||||||||||||||||||
3' TACCTTGGGCAGTCGGTGGTTCTGT 5'
5' ATGGAACCCATCAGCCACCAAGGCA 3'
   ||||||||| |||||||||||| ||
3' TACCTTGGGCAGTCGGTGGTTCTGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:30863365..30863389 25/25 Antisense target abr.L
Chr2S:6109718..6109742 23/25 Antisense target abr.S
Chr3L:122175984..122176008 21/25 Antisense off-target lrrk1.L
Publications
First: Control of local Rho GTPase crosstalk by Abr., Curr Biol 2011  
Most recent:
View All Papers