Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249111

Morpholino Name: acp1 MO1
Synonyms: XLPTP-AS
Target mRNA: acp1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' AATTTCCCCTTTCCAGCTCCTGTCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' AGACAGGAGCTGGAAAGGGGAAATT 3'
   |||||||||||||||||||||||||
3' TCTGTCCTCGACCTTTCCCCTTTAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:121222138..121222162 25/25 Antisense target acp1.S
Chr8S:12402975..12402999 22/25 Sense off-target wars1.S
Chr3S:38001990..38002014 21/25 Sense off-target spg21.S
Chr1L:122863373..122863397 21/25 Sense off-target hapln4.L
Chr7L:60791410..60791434 21/25 Sense off-target slc43a1.L
Chr2S:96685814..96685838 21/25 unknown
Chr9_10L:41912466..41912490 21/25 unknown
tropicalis 10.0 Chr10:44890887..44890911 21/25 Antisense off-target fbf1
Chr9:85579524..85579548 21/25 Sense off-target LOC116407773
Chr8:8126088..8126112 22/25 unknown
Publications
First: Low-molecular-weight protein tyrosine phosphatase is a positive component of the fibroblast growth factor receptor signaling pathway., Mol Cell Biol 2002  
Most recent:
View All Papers