Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249112

Morpholino Name: actb MO1
Synonyms: beta-actin AMO
Target mRNA: actb

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CAATATCGTCTTCCATTGTGATCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 25/25
genome
MO
5' CAGATCACAATGGAAGACGATATTG 3'
   |||||||||||||||||||||||||
3' GTCTAGTGTTACCTTCTGCTATAAC 5'
5' CAGATCACAATGGAAGACGATATTG 3'
   |||||||||||||||||||||||||
3' GTCTAGTGTTACCTTCTGCTATAAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:95179133..95179157 25/25 Antisense target actb.L
Chr9_10S:82907288..82907312 25/25 Antisense target actb.S
tropicalis 10.0 Chr4:108855769..108855793 21/25 Sense off-target cdc14a
Chr1:138074243..138074267 21/25 unknown
Publications
First: Asymmetrical beta-actin mRNA translation in growth cones mediates attractive turning to netrin-1., Nat Neurosci 2006  
Most recent:
View All Papers