Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249113

Morpholino Name: acvr1b MO1
Synonyms: ALK4
Target mRNA: acvr1b

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGGTAGCTCCGCCATAGTAATAGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genome
MO
5' GGCTATTACTATGGCGGAGCTACCG 3'
    ||||||||||||||||||||||||
3' GCGATAATGATACCGCCTCGATGGC 5'
5' GGCTATTACTATGGCGGAGCTACCG 3'
    ||||||||||||||||||||||||
3' GCGATAATGATACCGCCTCGATGGC 5'
5' GGCTATTACTATGGCGGAGCTACCG 3'
    ||||||||||||||||||||||||
3' GCGATAATGATACCGCCTCGATGGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:141636274..141636298 24/25 Antisense target acvr1b.L
Chr2S:126645338..126645362 24/25 Antisense target acvr1b.S
tropicalis 10.0 Chr2:135122757..135122781 24/25 Antisense target acvr1b
Publications
First: ALK4 functions as a receptor for multiple TGF beta-related ligands to regulate left-right axis determination and mesoderm induction in Xenopus., Dev Biol 2004        
Most recent:
View All Papers