Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249117

Morpholino Name: adam13 MO1
Synonyms: 13-1 MO
Target mRNA: adam13

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGTGCAGCCAACCCTCCGTCCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 21/25
genome
MO
5' ATGGGGACGGAGGGTTGGCTGCACA 3'
   |||||||||||||||||||||||||
3' TACCCCTGCCTCCCAACCGACGTGT 5'
5' ATGGGGACGGAGGGTCGGATGAGCA 3'
   ||||||||||||||| || ||  ||
3' TACCCCTGCCTCCCAACCGACGTGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:10453570..10453594 21/25 Antisense target adam33.L
tropicalis 10.0 Chr1:16305402..16305426 25/25 Antisense target adam33
Publications
First: Roles of ADAM13-regulated Wnt activity in early Xenopus eye development., Dev Biol 2012                            
Most recent:
View All Papers