Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249118

Morpholino Name: adam13 MO2
Synonyms: 13-2 MO
Target mRNA: adam13

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CCCCGGCTCAGTCCGCTCTCAGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/24 23/24
genome
MO
5' GGCTGAGAGCGGACTGAGCCGGGG 3'
   ||||||||||||||||||||||||
3' CCGACTCTCGCCTGACTCGGCCCC 5'
5' GGCTGAGAGCGGACTGAGCCGGGA 3'
   ||||||||||||||||||||||| 
3' CCGACTCTCGCCTGACTCGGCCCC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:3164831..3164854 23/24 Antisense target adam33.S
Chr3L:96955601..96955624 20/24 Sense off-target herc1.L
Chr3S:54836701..54836724 20/24 Sense off-target adam10.S
tropicalis 10.0 Chr1:16305427..16305450 24/24 Antisense target adam33
Chr4:344686..344709 20/24 unknown
Publications
First: Roles of ADAM13-regulated Wnt activity in early Xenopus eye development., Dev Biol 2012                            
Most recent:
View All Papers