Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249123

Morpholino Name: admp MO1
Synonyms: ADMPMO, Admp MO, admp morpholino
Target mRNA: admp

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGTCCATCTCATCAAGCTGCAGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' GAGCTGCAACTTGATGAGATGGACC 3'
   |||||||| ||||||||||||||||
3' CTCGACGTCGAACTACTCTACCTGG 5'
5' GAGCTGCAGCTTGATGAGATGGACC 3'
   |||||||||||||||||||||||||
3' CTCGACGTCGAACTACTCTACCTGG 5'
5' GAGCTGCAGCTTGATGAGATGGACC 3'
   |||||||||||||||||||||||||
3' CTCGACGTCGAACTACTCTACCTGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:114034940..114034964 25/25 Antisense target admp.L
Chr1S:95298080..95298104 25/25 Antisense target admp.S
tropicalis 10.0 Chr1:104483739..104483763 24/25 Antisense target admp
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
Most recent: Apcdd1 is a dual BMP/Wnt inhibitor in the developing nervous system and skin., Dev Biol 2020        
View All Papers