Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249180

Morpholino Name: bambi MO1
Synonyms: Bambi MO
Target mRNA: bambi

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGATTCCACCATCCAGCCCAGCGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 23/25
genome
MO
5' AAGCTGGGCTGGATGGTGGGATCTC 3'
   | ||||||||||||||||| |||||
3' TGCGACCCGACCTACCACCTTAGAG 5'
5' ACGCTGGGCTGGATGGTGGAATCTC 3'
   |||||||||||||||||||||||||
3' TGCGACCCGACCTACCACCTTAGAG 5'
5' ACGCGGGGCTGGATGGTGGCATCTC 3'
   |||| |||||||||||||| |||||
3' TGCGACCCGACCTACCACCTTAGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:23379011..23379035 25/25 Antisense target bambi.L
Chr6S:17682872..17682896 23/25 Antisense target bambi.S
Chr9_10L:39710793..39710817 21/25 Sense off-target LOC108705538
Chr3L:112698226..112698250 21/25 unknown
Chr9_10L:39543618..39543642 21/25 unknown
Chr9_10L:39552364..39552388 21/25 unknown
Chr9_10L:39566202..39566226 21/25 unknown
Chr9_10L:39573825..39573849 21/25 unknown
Chr9_10L:39590641..39590665 21/25 unknown
Chr9_10L:39621551..39621575 21/25 unknown
Chr9_10L:39628183..39628207 21/25 unknown
Chr9_10L:39643498..39643522 21/25 unknown
Chr9_10L:39653287..39653311 21/25 unknown
Chr9_10L:39656883..39656907 21/25 unknown
Chr9_10L:39663759..39663783 21/25 unknown
Chr9_10L:39684161..39684185 21/25 unknown
tropicalis 10.0 Chr6:24154131..24154155 23/25 Antisense target bambi
Chr3:142058355..142058379 21/25 Sense off-target LOC100170611
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
Most recent: Negative feedback in the bone morphogenetic protein 4 (BMP4) synexpression group governs its dynamic signaling range and canalizes development., Proc Natl Acad Sci U S A 2011        
View All Papers