Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249185

Morpholino Name: baz1b MO1
Synonyms:
Target mRNA: baz1b

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTTCTCGTGGGATGATAGTCCCGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GCGGGACTATCATCCCACGAGAAGC 3'
   |||||||||||||||||||||||||
3' CGCCCTGATAGTAGGGTGCTCTTCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:42225469..42225493 25/25 Antisense target baz1b.L
Chr2L:74004716..74004740 21/25 Antisense off-target LOC121399981
Publications
First: Williams Syndrome Transcription Factor is critical for neural crest cell function in Xenopus laevis., Mech Dev 2012                
Most recent:
View All Papers