Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249186

Morpholino Name: bcl6 MO1
Synonyms: BCL6 MO
Target mRNA: bcl6

Morpholino Type: uncategorized morpholino
Sequence: 5' TTGAGTTTGAGATGCCATAGTGCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' GGGCACTATGGCATCTCAAACTCTA 3'
   ||||||||||||||||||||||| |
3' CCCGTGATACCGTAGAGTTTGAGTT 5'
5' GGGCACTATGGCATCTCAAACTCAA 3'
   |||||||||||||||||||||||||
3' CCCGTGATACCGTAGAGTTTGAGTT 5'
5' GGGCACTATGGCATCTCAAACTCAA 3'
   |||||||||||||||||||||||||
3' CCCGTGATACCGTAGAGTTTGAGTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:110056698..110056722 25/25 Antisense target bcl6.L
Chr5S:90084823..90084847 25/25 Antisense target bcl6.S
Chr6L:56901468..56901492 21/25 Antisense off-target ulk4.L
tropicalis 10.0 Chr5:103329564..103329588 24/25 Antisense target bcl6
Chr10:25893358..25893382 21/25 unknown
Publications
First: BCL6 canalizes Notch-dependent transcription, excluding Mastermind-like1 from selected target genes during left-right patterning., Dev Cell 2010          
Most recent:
View All Papers