Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249187

Morpholino Name: bcor MO1
Synonyms: xtBcor ATG1
Target mRNA: bcor

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AAGCATTTTCTCTCCTTACGCGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genome
MO
5' AGCCGCGTAAGGAGAGAAAATGCTT 3'
   |||||||||||||||||||||||||
3' TCGGCGCATTCCTCTCTTTTACGAA 5'
5' AGCAGCATAAGGAGAGAAAATGCTT 3'
   ||| || ||||||||||||||||||
3' TCGGCGCATTCCTCTCTTTTACGAA 5'
5' AGCAGCGTAAGGAGAGAAAATGCTT 3'
   ||| |||||||||||||||||||||
3' TCGGCGCATTCCTCTCTTTTACGAA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:49852093..49852117 24/25 Antisense target bcor.S
Chr2L:81324501..81324525 23/25 Antisense target bcor.L
Chr4L:53285491..53285515 22/25 Antisense off-target LOC121402811
Chr7L:126412153..126412177 21/25 Sense off-target LOC121395505
tropicalis 10.0 Chr2:57390414..57390438 25/25 Antisense target bcor
Chr2:31571434..31571458 21/25 Antisense off-target specc1
Chr1:149072921..149072945 21/25 unknown
Publications
First: Left-sided embryonic expression of the BCL-6 corepressor, BCOR, is required for vertebrate laterality determination., Hum Mol Genet 2007                
Most recent:
View All Papers