Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249188

Morpholino Name: bcor MO2
Synonyms: xtBcor ATG2
Target mRNA: bcor

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCTCCCCCTTCTTATAAATCTGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 24/25
genome
MO
5' GACAGATTTATAAGAAGGGGGAGGC 3'
   |||||||||||||||||||||||||
3' CTGTCTAAATATTCTTCCCCCTCCG 5'
5' GACAGATTTAGAAGAAGGGGGAGGC 3'
   |||||||||| ||||||||||||||
3' CTGTCTAAATATTCTTCCCCCTCCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:81324526..81324550 24/25 Antisense target bcor.L
Chr4L:118281435..118281459 21/25 Sense off-target LOC100137612
tropicalis 10.0 Chr2:57390389..57390413 25/25 Antisense target bcor
Chr2:55403593..55403617 21/25 Antisense off-target f5
Chr4:153725576..153725600 21/25 Antisense off-target pbrm1
Publications
First: Left-sided embryonic expression of the BCL-6 corepressor, BCOR, is required for vertebrate laterality determination., Hum Mol Genet 2007                
Most recent:
View All Papers