Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249189

Morpholino Name: bdnf MO1
Synonyms: BDNF, BDNF MO, BDNF morpholino
Target mRNA: bdnf

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCACCTGATGGAACTTATTTTAGC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:10831750..10831774 21/25 Sense off-target vill.L
Chr1S:52388739..52388763 21/25 unknown
tropicalis 10.0 Chr8:105294517..105294541 21/25 Sense off-target tyro3
Publications
First: Pro-BDNF-induced synaptic depression and retraction at developing neuromuscular synapses., J Cell Biol 2009                
Most recent: Activity-dependent transcription of BDNF enhances visual acuity during development., Neuron 2011  
View All Papers