Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249190

Morpholino Name: bdnf MO2
Synonyms: bdnf
Target mRNA: bdnf

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGTCATCACTCTTCTCACCTGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/24 24/24
genome
MO
5' TCAGGTGAGAAGAGTGATGACCAT 3'
   ||||||||||||||||||||||||
3' AGTCCACTCTTCTCACTACTGGTA 5'
5' TCAGGTGAGAAGAGTGATGACCAT 3'
   ||||||||||||||||||||||||
3' AGTCCACTCTTCTCACTACTGGTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:15410715..15410738 24/24 Antisense target bdnf.S
Chr4S:8495195..8495218 24/24 Antisense off-target LOC108715060
Chr4L:96139734..96139757 20/24 Sense off-target cacna1e.L
Chr6L:8596076..8596099 20/24 Antisense off-target LOC108718692
Chr1L:40561178..40561201 20/24 unknown
tropicalis 10.0 Chr4:20980236..20980259 24/24 Antisense target bdnf
Chr3:22233447..22233470 20/24 Antisense off-target tbc1d9b
Chr3:78045647..78045670 20/24 Sense off-target fam185a
Chr2:174767202..174767225 20/24 Antisense off-target LOC116406442
Chr3:81447565..81447588 20/24 unknown
Publications
First: BDNF promotes target innervation of Xenopus mandibular trigeminal axons in vivo., BMC Dev Biol 2007                    
Most recent:
View All Papers