Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249191

Morpholino Name: bgn MO1
Synonyms: xBgn-Mo2
Target mRNA: bgn

Morpholino Type: uncategorized morpholino
Sequence: 5' CAATATACAAAGGTTCCTTCCAGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genome
MO
5' GCCTGGAAGGAATCTTTGCATATTG 3'
   |||||||||||| ||||| ||||||
3' CGGACCTTCCTTGGAAACATATAAC 5'
5' GCCTGGAAGGAGCCTTTGTATATTG 3'
   ||||||||||| |||||||||||||
3' CGGACCTTCCTTGGAAACATATAAC 5'
5' GCCTGGAAGGAACCTTTGTATATTG 3'
   |||||||||||||||||||||||||
3' CGGACCTTCCTTGGAAACATATAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:36393106..36393130 25/25 Antisense target bgn.S
Chr8L:13516898..13516922 24/25 Antisense target bgn.L
Chr8L:13516898..13516922 24/25 Sense off-target LOC108706216
Chr4L:138310517..138310541 21/25 Antisense off-target XB5969698.L
tropicalis 10.0 Chr8:23170740..23170764 23/25 Antisense target bgn
Publications
First: Biglycan is a new extracellular component of the Chordin-BMP4 signaling pathway., EMBO J 2005  
Most recent:
View All Papers