Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249192

Morpholino Name: bgn MO2
Synonyms: xBgn-Mo1
Target mRNA: bgn

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCATAAGAGAAGCAATACCTTCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 25/25
genome
MO
5' ATGAAGGTATTGCTTCTCTTATGCT 3'
   |||||||||||||||||||||||||
3' TACTTCCATAACGAAGAGAATACGA 5'
5' ATGAAGGTATTGCTTCTCTTATGCT 3'
   |||||||||||||||||||||||||
3' TACTTCCATAACGAAGAGAATACGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:13533975..13533999 25/25 Antisense target bgn.L
Chr8S:36412003..36412027 25/25 Antisense target bgn.S
Chr8L:13533975..13533999 25/25 Sense off-target LOC108706216
Chr2L:170931584..170931608 21/25 Antisense off-target atm.L
Chr2S:96740149..96740173 21/25 Antisense off-target impg2.S
Chr4L:17075639..17075663 21/25 unknown
tropicalis 10.0 Chr4:114775099..114775123 21/25 Antisense off-target ubn2
Chr4:114775099..114775123 21/25 Sense off-target gucy2c
Chr9:32277347..32277371 21/25 unknown
Publications
First: Biglycan is a new extracellular component of the Chordin-BMP4 signaling pathway., EMBO J 2005  
Most recent:
View All Papers