Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249193

Morpholino Name: bicc1 MO1
Synonyms: bicc1 TBMO2 S, xBic-C- MO1, xBic-CMO1, xBicC MO1
Target mRNA: bicc1

Morpholino Type: translation blocking morpholino
Sequence: 5' TAGACTCGCACTGAGCCGCCATTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 21/25 25/25
genome
MO
5' ACCATGGCGGCTCAGTGCGACACTA 3'
   |  |||||||||||||||||  |||
3' TCTTACCGCCGAGTCACGCTCAGAT 5'
5' AGAATGGCGGCTCAGTGCGAGTCTA 3'
   |||||||||||||||||||||||||
3' TCTTACCGCCGAGTCACGCTCAGAT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:7647304..7647328 25/25 Antisense target bicc1.S
Chr8L:8984725..8984749 21/25 Antisense off-target ass1.S
tropicalis 10.0 Chr7:15778371..15778395 21/25 Antisense target bicc1
Publications
First: Xenopus Bicaudal-C is required for the differentiation of the amphibian pronephros., Dev Biol 2007                    
Most recent: Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5., Nat Commun 2021                                
View All Papers