Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249194

Morpholino Name: bicc1 MO2
Synonyms: bicc1 TBMO1 L, xBic-C-MO2, xBic-CMO2, xBicC MO2
Target mRNA: bicc1

Morpholino Type: translation blocking morpholino
Sequence: 5' CCATTGTGCTACTGCCGCCGCTAAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GTTAGCGGCGGCAGTAGCACAATGG 3'
   |||||||||||||||||||||||||
3' CAATCGCCGCCGTCATCGTGTTACC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:10391625..10391649 25/25 Antisense target bicc1.L
Publications
First: Xenopus Bicaudal-C is required for the differentiation of the amphibian pronephros., Dev Biol 2007                    
Most recent: Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5., Nat Commun 2021                                
View All Papers