Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249195

Morpholino Name: bix1.1 MO1
Synonyms: Bix3MO, bix3 MO
Target mRNA: bix1.1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTGGGTCTGTACTTCCAAATCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CAGATTTGGAAGTACAGACCCAGGA 3'
   |||||||||||||||||||||||||
3' GTCTAAACCTTCATGTCTGGGTCCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:17997910..17997934 25/25 Antisense target bix1.1.L
Chr5L:17990823..17990847 25/25 Antisense off-target bix1.3.L
Chr5S:139013829..139013853 21/25 Antisense off-target LOC108718302
Chr7L:89844955..89844979 22/25 unknown
Chr8L:120376599..120376623 21/25 unknown
tropicalis 10.0 Chr7:120349068..120349092 21/25 unknown
Publications
First: Regulation of apoptosis in theXenopus embryo by Bix3., Development 2003                    
Most recent:
View All Papers