Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249196

Morpholino Name: bmp1 MO1
Synonyms: BMP1 MO
Target mRNA: bmp1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCCTGTGGGATATCATTGTGTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GGACACAATGATATCCCACAGGCTG 3'
   |||||||||||||||||||||||||
3' CCTGTGTTACTATAGGGTGTCCGAC 5'
5' GGACACAATGATATCCCACAGGCTG 3'
   |||||||||||||||||||||||||
3' CCTGTGTTACTATAGGGTGTCCGAC 5'
5' GGACACAATGATATCCCACAGGCTG 3'
   |||||||||||||||||||||||||
3' CCTGTGTTACTATAGGGTGTCCGAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:138011733..138011757 25/25 Antisense target bmp1.L
Chr3S:23371290..23371314 25/25 Antisense target bmp1.S
Chr6L:1711029..1711053 21/25 Sense off-target sspo.L
Chr4S:117039449..117039473 21/25 unknown
tropicalis 10.0 Chr3:129614507..129614531 25/25 Antisense target bmp1
Chr3:45890165..45890189 22/25 Sense off-target dbn1
Publications
First: Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation., Cell 2008                    
Most recent: Generation of animal form by the Chordin/Tolloid/BMP gradient: 100 years after D'Arcy Thompson., Dev Growth Differ 2017              
View All Papers