Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249197

Morpholino Name: bmp2 MO1
Synonyms: Bmp2, Bmp2-MO, bmp2 MO
Target mRNA: bmp2

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCCCAGCGACCATTGTCAACCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 25/25
genome
MO
5' CAGGTTGACAATGGTCGCTGGGATC 3'
   |||||||||||||||||||||||||
3' GTCCAACTGTTACCAGCGACCCTAG 5'
5' CAGGTTGACAATGGTCGCTGGGATC 3'
   |||||||||||||||||||||||||
3' GTCCAACTGTTACCAGCGACCCTAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:1814491..1814515 25/25 Antisense target bmp2.L
Chr5S:26233584..26233608 25/25 Antisense target bmp2.S
Chr3L:9247424..9247448 22/25 Antisense off-target LOC121400960
Chr4S:13747577..13747601 21/25 Antisense off-target astl2a.S
Chr2S:67564212..67564236 22/25 unknown
Chr2S:67685017..67685041 21/25 unknown
Chr2S:81840660..81840684 21/25 unknown
Chr2S:81945346..81945370 21/25 unknown
Chr2S:82023863..82023887 21/25 unknown
Chr9_10L:18078333..18078357 21/25 unknown
Chr9_10L:34490516..34490540 21/25 unknown
Chr9_10S:15622261..15622285 21/25 unknown
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: Apcdd1 is a dual BMP/Wnt inhibitor in the developing nervous system and skin., Dev Biol 2020        
View All Papers