Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249198

Morpholino Name: bmp3 MO1
Synonyms: xBMP-3 MO
Target mRNA: bmp3

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGCCAGGGGCGACACTCTGCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genome
MO
5' AATGGCAGAGTGTCGCCCCTGGCTT 3'
    ||||||||||||||||||||||| 
3' CTACCGTCTCACAGCGGGGACCGAG 5'
5' GATGGCAGAGTGTCGCCCCTGGCTC 3'
   |||||||||||||||||||||||||
3' CTACCGTCTCACAGCGGGGACCGAG 5'
5' GATGGCAGAGTGTCGCCCCTGGCTG 3'
   |||||||||||||||||||||||| 
3' CTACCGTCTCACAGCGGGGACCGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:103857962..103857986 25/25 Antisense target bmp3.L
Chr1S:86094663..86094687 24/25 Antisense target bmp3.S
tropicalis 10.0 Chr1:95860123..95860147 23/25 Antisense target bmp3
Publications
First: Coordination of BMP-3b and cerberus is required for head formation of Xenopus embryos., Dev Biol 2003                              
Most recent:
View All Papers