Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249199

Morpholino Name: bmp4 MO1
Synonyms: BMP4 MO, Bmp4, TNeu045c17, XtBMP4, bmp4-2ome
Target mRNA: bmp4

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCATTCGGTTACCAGGAATCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CATGATTCCTGGTAACCGAATGCTG 3'
   |||||||||||||||||||||||||
3' GTACTAAGGACCATTGGCTTACGAC 5'
5' CATGATTCCTGGTAACCGAATGCTG 3'
   |||||||||||||||||||||||||
3' GTACTAAGGACCATTGGCTTACGAC 5'
5' CATGATTCCTGGTAACCGAATGCTG 3'
   |||||||||||||||||||||||||
3' GTACTAAGGACCATTGGCTTACGAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:85910707..85910731 25/25 Antisense target bmp4.L
Chr8S:13799259..13799283 25/25 Antisense target bmp4.S
Chr1S:103683582..103683606 21/25 Antisense off-target LOC108703701
Chr1S:96912597..96912621 21/25 Antisense off-target LOC121399376
Chr4S:23550949..23550973 21/25 Antisense off-target LOC108702811
Chr9_10L:18759747..18759771 21/25 Antisense off-target LOC108701997
Chr9_10L:18759747..18759771 21/25 Antisense off-target LOC108700957
Chr9_10S:35789079..35789103 21/25 Antisense off-target LOC108702210
Chr5S:74185446..74185470 21/25 Antisense off-target LOC108717977
Chr1S:133965976..133966000 21/25 unknown
tropicalis 10.0 Chr8:94980952..94980976 25/25 Antisense target bmp4
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: R-spondins are BMP receptor antagonists in Xenopus early embryonic development., Nat Commun 2020                                              
View All Papers