Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249201

Morpholino Name: bmp4 MO3
Synonyms: BMP-4MO1
Target mRNA: bmp4

Morpholino Type: uncategorized morpholino
Sequence: 5' TTGACAGAAAACAAGGCATAGAAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25 24/25
genome
MO
5' TTTTCTATGCCTTGTTTTCTGTCAG 3'
   |||||||||||||||||||||||| 
3' AAAAGATACGGAACAAAAGACAGTT 5'
5' TTTTCTATGCCTTGTTTTGTGTCAG 3'
   |||||||||||||||||| ||||| 
3' AAAAGATACGGAACAAAAGACAGTT 5'
5' TTTTCTATGCCTTGTTTTCTGTCAG 3'
   |||||||||||||||||||||||| 
3' AAAAGATACGGAACAAAAGACAGTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:13798814..13798838 24/25 Antisense target bmp4.S
Chr8L:85911411..85911435 23/25 Antisense target bmp4.L
Chr7L:72641668..72641692 22/25 Antisense off-target tirap.L
Chr2S:5297118..5297142 21/25 Sense off-target git1.S
Chr1L:86835182..86835206 21/25 Antisense off-target ppef2.L
Chr5L:157408780..157408804 21/25 Antisense off-target itsn2.L
Chr7S:18479704..18479728 21/25 Antisense off-target wbp1l.S
Chr8L:9857016..9857040 21/25 Sense off-target tor1a.L
Chr9_10L:94780364..94780388 21/25 Antisense off-target wipi2.L
Chr2L:56977053..56977077 21/25 Antisense off-target map7d1.L
Chr2S:163212796..163212820 21/25 Antisense off-target picalm.S
Chr4L:111654773..111654797 21/25 Sense off-target atf7ip.L
Chr5S:30559467..30559491 21/25 Sense off-target abhd12.S
Chr8S:101514041..101514065 21/25 Sense off-target ndufs2.S
Chr7L:96079765..96079789 21/25 Antisense off-target tmem240.L
Chr8L:58327040..58327064 21/25 Sense off-target il13ra2.L
Chr1S:138945619..138945643 21/25 Antisense off-target LOC108707095
Chr2S:72229899..72229923 21/25 Sense off-target LOC121400591
Chr3L:80388070..80388094 21/25 Antisense off-target LOC108711168
Chr8L:127277007..127277031 21/25 Antisense off-target LOC121397219
Chr1S:107249940..107249964 22/25 unknown
Chr1S:87625642..87625666 22/25 unknown
Chr3S:24669935..24669959 22/25 unknown
Chr3S:57398246..57398270 22/25 unknown
Chr7L:10571354..10571378 22/25 unknown
Chr1L:16918604..16918628 21/25 unknown
Chr1L:31400276..31400300 21/25 unknown
Chr1L:42737959..42737983 21/25 unknown
Chr1S:191315620..191315644 21/25 unknown
Chr1S:7062949..7062973 21/25 unknown
Chr2L:158169888..158169912 21/25 unknown
Chr2S:143809464..143809488 21/25 unknown
Chr2S:147792413..147792437 21/25 unknown
Chr3L:141118598..141118622 21/25 unknown
Chr2S:56540577..56540601 21/25 unknown
Chr3S:27543731..27543755 21/25 unknown
Chr8L:61613094..61613118 21/25 unknown
Chr9_10L:110904727..110904751 21/25 unknown
Chr9_10L:44467038..44467062 21/25 unknown
tropicalis 10.0 Chr8:94981744..94981768 24/25 Antisense target bmp4
Chr3:54154593..54154617 22/25 Antisense off-target mgat4c
Chr9:39214194..39214218 22/25 Antisense off-target rbfox1
Chr8:59380572..59380596 21/25 Antisense off-target esx1
Chr2:91873371..91873395 21/25 Sense off-target brip1
Chr4:74373391..74373415 21/25 Antisense off-target fhod1
Chr6:42547858..42547882 21/25 Antisense off-target tax1bp1
Chr1:175629261..175629285 21/25 unknown
Chr1:195053293..195053317 21/25 unknown
Publications
First: The initiation of Hox gene expression in Xenopus laevis is controlled by Brachyury and BMP-4., Dev Biol 2004                    
Most recent:
View All Papers