Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249202

Morpholino Name: bmp4 MO4
Synonyms: BMP4 MO
Target mRNA: bmp4

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGGAATCATGGTGTCTTGACAGA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:101389755..101389779 22/25 Antisense off-target fbxo9.L
Chr1L:174098112..174098136 22/25 Antisense off-target LOC398642
Chr4S:12182593..12182617 21/25 Sense off-target gh2.S
Chr2S:163630978..163631002 21/25 unknown
tropicalis 10.0 Chr2:41165955..41165979 22/25 Sense off-target cdkl5
Chr1:67503524..67503548 21/25 Sense off-target col25a1.2
Publications
First: Twisted gastrulation is required for forebrain specification and cooperates with Chordin to inhibit BMP signaling during X. tropicalis gastrulation., Dev Biol 2006                                    
Most recent:
View All Papers