Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249203

Morpholino Name: bmp7.2 MO1
Synonyms: Bmp7, Bmp7-MO, bmp7 MO
Target mRNA: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTACTGTCAAAGCATTCATTTTGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' GACAAAATGAATGCTTTGATAGTAA 3'
   ||||||||||||||||||| |||||
3' CTGTTTTACTTACGAAACTGTCATT 5'
5' GACAAAATGAATGCTTTGACAGTAA 3'
   |||||||||||||||||||||||||
3' CTGTTTTACTTACGAAACTGTCATT 5'
5' GACAAAATGAATGCTTTGATAGTAA 3'
   ||||||||||||||||||| |||||
3' CTGTTTTACTTACGAAACTGTCATT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:103963392..103963416 25/25 Antisense target bmp7.2.L
Chr3S:55326516..55326540 24/25 Antisense target bmp7.2.S
Chr6S:119692141..119692165 21/25 Antisense off-target angpt1.S
Chr8S:3615082..3615106 21/25 Antisense off-target znf106.S
Chr6L:100765517..100765541 21/25 Sense off-target LOC108719153
Chr4L:55492917..55492941 22/25 unknown
Chr3S:34476653..34476677 21/25 unknown
Chr4L:74240136..74240160 21/25 unknown
tropicalis 10.0 Chr3:98670489..98670513 24/25 Antisense target bmp7.2
Chr6:108639386..108639410 22/25 Sense off-target mib1
Chr8:108094649..108094673 22/25 Antisense off-target znf106
Chr1:93976663..93976687 21/25 Antisense off-target fsd1
Chr5:25362277..25362301 21/25 Sense off-target LOC105947449
Chr5:56091494..56091518 22/25 unknown
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: Apcdd1 is a dual BMP/Wnt inhibitor in the developing nervous system and skin., Dev Biol 2020        
View All Papers