Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249204

Morpholino Name: bmp7.2 MO2
Synonyms: BMP7-MO
Target mRNA: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTCAAAGCATTCATTTTGTCAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genome
MO
5' TTTGACAAAATGAATGCTTTGATAG 3'
   |||||||||||||||||||||| ||
3' AAACTGTTTTACTTACGAAACTGTC 5'
5' TTTGACAAAATGAATGCTTTGACAG 3'
   |||||||||||||||||||||||||
3' AAACTGTTTTACTTACGAAACTGTC 5'
5' TCTGACAAAATGAATGCTTTGATAG 3'
   | |||||||||||||||||||| ||
3' AAACTGTTTTACTTACGAAACTGTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:103963395..103963419 25/25 Antisense target bmp7.2.L
Chr3S:55326513..55326537 23/25 Antisense target bmp7.2.S
Chr6L:90528718..90528742 21/25 Antisense off-target serpinb10.L
Chr2S:77674807..77674831 22/25 unknown
Chr4L:55492920..55492944 22/25 unknown
Chr5L:116296424..116296448 21/25 unknown
Chr6L:69480359..69480383 21/25 unknown
Chr6L:69480737..69480761 21/25 unknown
Chr6L:86075580..86075604 21/25 unknown
Chr6S:125979622..125979646 21/25 unknown
Chr9_10S:49146330..49146354 21/25 unknown
tropicalis 10.0 Chr3:98670492..98670516 24/25 Antisense target bmp7.2
Chr1:93976666..93976690 21/25 Antisense off-target fsd1
Chr5:119548654..119548678 21/25 Antisense off-target gucy1b2
Chr5:25362274..25362298 21/25 Sense off-target LOC105947449
Chr2:125439883..125439907 21/25 unknown
Chr6:99458152..99458176 21/25 unknown
Publications
First: Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis., Development 2003                
Most recent:
View All Papers