Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249205

Morpholino Name: bmp7.2 MO3
Synonyms: BMP7 MO
Target mRNA: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTACTATCAAAGCATTCATTTTGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genome
MO
5' GACAAAATGAATGCTTTGATAGTAA 3'
   |||||||||||||||||||||||||
3' CTGTTTTACTTACGAAACTATCATT 5'
5' GACAAAATGAATGCTTTGACAGTAA 3'
   ||||||||||||||||||| |||||
3' CTGTTTTACTTACGAAACTATCATT 5'
5' GACAAAATGAATGCTTTGATAGTAA 3'
   |||||||||||||||||||||||||
3' CTGTTTTACTTACGAAACTATCATT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:55326516..55326540 25/25 Antisense target bmp7.2.S
Chr3L:103963392..103963416 24/25 Antisense target bmp7.2.L
Chr9_10S:72686790..72686814 21/25 Sense off-target LOC108702278
Chr4L:74240136..74240160 21/25 unknown
tropicalis 10.0 Chr3:98670489..98670513 25/25 Antisense target bmp7.2
Chr6:108639386..108639410 21/25 Sense off-target mib1
Chr8:108094649..108094673 21/25 Antisense off-target znf106
Chr1:209685133..209685157 21/25 unknown
Chr5:56091494..56091518 21/25 unknown
Chr9:78668715..78668739 21/25 unknown
Publications
First: Twisted gastrulation is required for forebrain specification and cooperates with Chordin to inhibit BMP signaling during X. tropicalis gastrulation., Dev Biol 2006                                    
Most recent:
View All Papers