Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249206

Morpholino Name: bmper MO1
Synonyms: CV2 MO
Target mRNA: bmper

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCCAGTGGAGAAGCAGCTGTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' ATGCACAGCTGCCCCTCCACTGGCA 3'
   ||||||||||||  |||||||||||
3' TACGTGTCGACGAAGAGGTGACCGT 5'
5' ATGCACAGCTGCTTCTCCACTGGCA 3'
   |||||||||||||||||||||||||
3' TACGTGTCGACGAAGAGGTGACCGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:66190494..66190518 25/25 Antisense target bmper.L
Chr6L:66193167..66193191 22/25 Antisense target bmper.L
Chr9_10L:106572085..106572109 21/25 Sense off-target micall2.L
Chr6S:102512100..102512124 21/25 Antisense off-target LOC108695312
Chr5L:59991893..59991917 22/25 unknown
Chr5S:29145455..29145479 21/25 unknown
Chr2S:157240704..157240728 21/25 unknown
Chr6S:106869472..106869496 21/25 unknown
tropicalis 10.0 Chr6:62446055..62446079 23/25 Antisense target bmper
Chr6:62443500..62443524 22/25 Antisense target bmper
Chr7:69046971..69046995 21/25 Sense off-target ntm
Chr4:106932341..106932365 21/25 Sense off-target tada1
Chr6:79053826..79053850 21/25 Sense off-target fbxl7
Chr1:181407475..181407499 21/25 unknown
Publications
First: Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning., Dev Cell 2008                              
Most recent:
View All Papers