Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249207

Morpholino Name: bmper MO2
Synonyms: CV2 MO1
Target mRNA: bmper

Morpholino Type: uncategorized morpholino
Sequence: 5' TATAGCATCCAGACTGTTGCAGGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' AACCTGCAACAGCCTGGATGCTGTA 3'
   |||||||||||| ||||||||| ||
3' TTGGACGTTGTCAGACCTACGATAT 5'
5' AACCTGCAACAGTCTGGATGCTATA 3'
   |||||||||||||||||||||||||
3' TTGGACGTTGTCAGACCTACGATAT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:66190464..66190488 25/25 Antisense target bmper.L
Chr6L:66193137..66193161 23/25 Antisense target bmper.L
Chr1S:56109026..56109050 21/25 unknown
Chr5S:34560883..34560907 21/25 unknown
tropicalis 10.0 Chr6:62443470..62443494 23/25 Antisense target bmper
Publications
First: Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning., Dev Cell 2008                              
Most recent:
View All Papers