Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249208

Morpholino Name: bmper MO3
Synonyms: CV2 MO2
Target mRNA: bmper

Morpholino Type: uncategorized morpholino
Sequence: 5' TTAGAGTGAGGAGTCAAGAACAGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' CTCTGTTCTTGACTCCTGACTCTAA 3'
   ||||||||||||||||| |||||||
3' GAGACAAGAACTGAGGAGTGAGATT 5'
5' CTCTGTTCTTGACTCCTCACTCTAA 3'
   |||||||||||||||||||||||||
3' GAGACAAGAACTGAGGAGTGAGATT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:66190439..66190463 25/25 Antisense target bmper.L
Chr9_10S:29305586..29305610 21/25 Antisense off-target cbx2.S
Chr5S:40860122..40860146 21/25 Sense off-target LOC108717837
Chr5S:40862728..40862752 21/25 Sense off-target LOC108717837
Chr1S:69839759..69839783 22/25 unknown
Chr6L:66007293..66007317 21/25 unknown
tropicalis 10.0 Chr6:62443446..62443470 24/25 Antisense target bmper
Chr6:62445999..62446023 24/25 Antisense target bmper
Chr2:92755055..92755079 22/25 Antisense off-target bcas3
Publications
First: Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning., Dev Cell 2008                              
Most recent:
View All Papers