Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249209

Morpholino Name: bmpr2 MO1
Synonyms: BRII E12SD-MO
Target mRNA: bmpr2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACACTGTGTGCTGCAGTTATCCATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' TATGGATAACTGCAGCACACAGTGT 3'
   |||||||||||||||||||||||||
3' ATACCTATTGACGTCGTGTGTCACA 5'
5' TATGGATAACTGCAGCACACAGTGT 3'
   |||||||||||||||||||||||||
3' ATACCTATTGACGTCGTGTGTCACA 5'
5' TATGGATAACTGCAGCACACAGTGT 3'
   |||||||||||||||||||||||||
3' ATACCTATTGACGTCGTGTGTCACA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:89719192..89719216 25/25 Antisense target bmpr2.L
Chr9_10S:78614384..78614408 25/25 Antisense target bmpr2.S
Chr2S:103506151..103506175 21/25 Sense off-target LOC108708959
tropicalis 10.0 Chr9:52447549..52447573 25/25 Antisense target bmpr2
Chr2:139678534..139678558 21/25 Sense off-target nxph4
Chr1:87787804..87787828 21/25 unknown
Publications
First: Jiraiya attenuates BMP signaling by interfering with type II BMP receptors in neuroectodermal patterning., Dev Cell 2010      
Most recent:
View All Papers