Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249210

Morpholino Name: bmpr2 MO2
Synonyms: BMPRII-5'MO
Target mRNA: bmpr2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCACAGAACACTCTCCTCAGCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' GGGCTGAGGAGATTGCTCTGTGAGA 3'
    ||||||||||| || |||||||||
3' TCCGACTCCTCTCACAAGACACTCT 5'
5' AGGCTGAGGAGAGTGTTCTGTGAGA 3'
   |||||||||||||||||||||||||
3' TCCGACTCCTCTCACAAGACACTCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:89807148..89807172 25/25 Antisense target bmpr2.L
Chr6S:728794..728818 21/25 Antisense off-target LOC121395196
Chr6S:728687..728711 21/25 Antisense off-target LOC121395196
Chr6S:728687..728711 21/25 Antisense off-target LOC108719641
Chr6S:728794..728818 21/25 Antisense off-target LOC108719641
Chr9_10S:111122067..111122091 21/25 Antisense off-target LOC108702347
Chr9_10S:78697228..78697252 25/25 unknown
Chr9_10S:78698508..78698532 23/25 unknown
tropicalis 10.0 Chr9:52349989..52350013 22/25 Antisense target bmpr2
Chr3:7818216..7818240 21/25 Sense off-target svopl
Chr3:7818287..7818311 21/25 Sense off-target svopl
Chr3:7818578..7818602 21/25 Sense off-target svopl
Chr3:7818650..7818674 21/25 Sense off-target svopl
Chr3:7818795..7818819 21/25 Sense off-target svopl
Chr3:7818940..7818964 21/25 Sense off-target svopl
Chr3:7819012..7819036 21/25 Sense off-target svopl
Publications
First: Jiraiya attenuates BMP signaling by interfering with type II BMP receptors in neuroectodermal patterning., Dev Cell 2010      
Most recent:
View All Papers