Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249211

Morpholino Name: brca1 MO1
Synonyms: xBRCA1 AS#3
Target mRNA: brca1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCCTGTCCCTTAAATGCAACTTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 22/24
genome
MO
5' CAAGTTGCATTTAAGGGACAGGTA 3'
   ||||||||||||||||||||||  
3' GTTCAACGTAAATTCCCTGTCCTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:35051571..35051594 22/24 Antisense target brca1.L
Chr8L:117707379..117707402 21/24 Sense off-target setdb1.L
Chr1L:209361114..209361137 20/24 Antisense off-target arl15.L
Chr2L:157404984..157405007 20/24 Antisense off-target lima1.L
Chr6S:125855691..125855714 20/24 Antisense off-target ntaq1.S
Chr9_10S:64963179..64963202 20/24 Sense off-target scn1a.S
Chr7S:92209508..92209531 20/24 Sense off-target prpf31.S
Chr7S:4817333..4817356 20/24 Antisense off-target XB1017155.S
tropicalis 10.0 Chr3:86192729..86192752 20/24 Sense off-target exoc4
Publications
First: Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development., Proc Natl Acad Sci U S A 2001                  
Most recent:
View All Papers