Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249212

Morpholino Name: brca1 MO2
Synonyms: xBRCA1 AS#2
Target mRNA: brca1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACTTGCTCGCTGAGGGCACACAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GTGTGTGCCCTCAGCGAGCAAGTTG 3'
   |||||||||||||||||||||||||
3' CACACACGGGAGTCGCTCGTTCAAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:35051588..35051612 25/25 Antisense target brca1.L
Publications
First: Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development., Proc Natl Acad Sci U S A 2001                  
Most recent:
View All Papers