Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249220

Morpholino Name: emsy MO1
Synonyms: XtEMSY MO1, c11orf30 MO1
Target mRNA: emsy

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACACCACCGGCATCCTGGCCTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' AGAGGCCAGGATGCCGGTGGTGTGG 3'
   |||||||||||||||||||||||||
3' TCTCCGGTCCTACGGCCACCACACC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr2:173351362..173351386 25/25 Antisense target emsy
Chr6:121073233..121073257 22/25 unknown
Publications
First: Loss of Xenopus tropicalis EMSY causes impairment of gastrulation and upregulation of p53., N Biotechnol 2011                  
Most recent:
View All Papers