Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249221

Morpholino Name: emsy MO2
Synonyms: XtEMSY MO2, c11orf30 MO2
Target mRNA: emsy

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGCCTCTCCTCCACAGAGCGCCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 23/25
genome
MO
5' AGGGCGCTCTGTGGAGGAGAGGCCA 3'
   |||||||||||||||||||||||||
3' TCCCGCGAGACACCTCCTCTCCGGT 5'
5' AGGGCGCCCTGTGGAGGAGAAGCCA 3'
   ||||||| |||||||||||| ||||
3' TCCCGCGAGACACCTCCTCTCCGGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:163929539..163929563 23/25 Antisense target emsy.S
Chr2L:183738273..183738297 25/25 Antisense off-target LOC108707623
Chr7L:122288886..122288910 21/25 Sense off-target cacng7.L
tropicalis 10.0 Chr2:173351345..173351369 25/25 Antisense target emsy
Publications
First: Loss of Xenopus tropicalis EMSY causes impairment of gastrulation and upregulation of p53., N Biotechnol 2011                  
Most recent:
View All Papers