Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249276

Morpholino Name: ada2 MO2
Synonyms: Xcecr1-1-5'UTR MO, cecr1 MO2
Target mRNA: ada2

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' ATTCTCTCAGTCTCCTCTAATCCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 23/25
genome
MO
5' CAGGATTAGAGGAGACTGAGAGGTT 3'
   ||||||||||||||||||||||  |
3' GTCCTAATCTCCTCTGACTCTCTTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:5318136..5318160 23/25 Antisense target ada2.S
Chr9_10L:91657156..91657180 21/25 Antisense off-target fastkd2.L
Chr9_10S:17013363..17013387 21/25 Antisense off-target LOC108702664
Chr1L:149365173..149365197 21/25 unknown
Publications
First: The extracellular adenosine deaminase growth factor, ADGF/CECR1, plays a role in Xenopus embryogenesis via the adenosine/P1 receptor., J Biol Chem 2008  
Most recent:
View All Papers