Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249277

Morpholino Name: ada2 MO3
Synonyms: Xl_cecr1-2 MO, cecr1 MO3
Target mRNA: ada2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAACCAATGGGAGACGCACGCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 23/25
genome
MO
5' ATGGCGTGCGTCTCCCATTGGTTGC 3'
   |||||||||||||||||||||||||
3' TACCGCACGCAGAGGGTAACCAACG 5'
5' ATGACGTGCATCTCCCATTGGTTGC 3'
   ||| ||||| |||||||||||||||
3' TACCGCACGCAGAGGGTAACCAACG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:7970505..7970529 25/25 Antisense target ada2.L
Chr3S:5321390..5321414 23/25 Antisense target ada2.S
Chr3L:7864573..7864597 25/25 Antisense off-target LOC121400950
Chr9_10L:54274059..54274083 21/25 unknown
Publications
First: The extracellular adenosine deaminase growth factor, ADGF/CECR1, plays a role in Xenopus embryogenesis via the adenosine/P1 receptor., J Biol Chem 2008  
Most recent:
View All Papers