Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249278

Morpholino Name: ada2 MO4
Synonyms: Xcecr1-2-5'UTR MO, cecr1 MO4
Target mRNA: ada2

Morpholino Type: uncategorized morpholino
Sequence: 5' TAATTCTCTCTCTCCTCTAATCCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 22/25
genome
MO
5' CAGGATTAGAGGAGAGAGAGGTTTG 3'
   ||||||||||||||||||||  || 
3' GTCCTAATCTCCTCTCTCTCTTAAT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:7978696..7978720 22/25 Antisense target ada2.L
Chr3L:7872190..7872214 22/25 Antisense off-target LOC121400950
Chr4S:22503422..22503446 21/25 Antisense off-target sox6.S
Chr7S:66712813..66712837 21/25 Antisense off-target usp2.S
Chr1L:195644530..195644554 21/25 Sense off-target rasa1.L
Chr2S:157300787..157300811 21/25 unknown
Chr3L:151169455..151169479 21/25 unknown
Chr4L:63276329..63276353 21/25 unknown
Chr6S:38391535..38391559 21/25 unknown
tropicalis 10.0 Chr2:165881443..165881467 22/25 Antisense off-target slc36a4
Chr3:92191164..92191188 21/25 Antisense off-target arih1
Chr6:107161868..107161892 21/25 Antisense off-target emilin2
Chr5:17186629..17186653 21/25 unknown
Chr6:98062750..98062774 21/25 unknown
Publications
First: The extracellular adenosine deaminase growth factor, ADGF/CECR1, plays a role in Xenopus embryogenesis via the adenosine/P1 receptor., J Biol Chem 2008  
Most recent:
View All Papers