Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249331

Morpholino Name: ctnnb1 MO2
Synonyms: bcat, beta-catenin morpholino
Target mRNA: ctnnb1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTCAACAGTTTCCAAAGAACCAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genome
MO
5' CCTGGTTCTTTGGAAACTGTTGAAA 3'
   |||||||||||||||||||||||||
3' GGACCAAGAAACCTTTGACAACTTT 5'
5' CCTGGTTCTTTGGAAACGGTTGAAA 3'
   ||||||||||||||||| |||||||
3' GGACCAAGAAACCTTTGACAACTTT 5'
5' CCTGGTTCTTTGGAAACTGTTGAAA 3'
   |||||||||||||||||||||||||
3' GGACCAAGAAACCTTTGACAACTTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:46318428..46318452 25/25 Antisense target ctnnb1.S
Chr6L:56687417..56687441 24/25 Antisense target ctnnb1.L
Chr2L:73517505..73517529 22/25 Sense off-target LOC108708155
Chr3L:113891792..113891816 21/25 Sense off-target unc45a.L
Chr1L:456271..456295 21/25 Antisense off-target LOC108704858
Chr3L:58487759..58487783 21/25 Antisense off-target LOC108711038
Chr8L:65727772..65727796 21/25 Antisense off-target LOC108698939
Chr2S:11093252..11093276 21/25 unknown
Chr2S:159424587..159424611 21/25 unknown
Chr5S:78155467..78155491 21/25 unknown
Chr5S:9986662..9986686 21/25 unknown
Chr6L:19520279..19520303 21/25 unknown
Chr7L:94336176..94336200 21/25 unknown
tropicalis 10.0 Chr6:53369028..53369052 25/25 Antisense target ctnnb1
Chr4:119773021..119773045 21/25 Sense off-target prg4
Chr6:82995286..82995310 21/25 Sense off-target cdh9
Chr3:117338308..117338332 21/25 unknown
Publications
First: Techniques and probes for the study of Xenopus tropicalis development., Dev Dyn 2002            
Most recent: Mitochondrial leak metabolism induces the Spemann-Mangold Organizer via Hif-1α in Xenopus., Dev Cell 2023                          
View All Papers