Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249422

Morpholino Name: ebf3 MO1
Synonyms: Ebf3 MO, ebf3
Target mRNA: ebf3

Morpholino Type: uncategorized morpholino
Sequence: 5' GTATATTTTCCTGAATCCCAAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGTTTGGGATTCAGGAAAATATAC 3'
   |||||||||||||||||||||||||
3' TACAAACCCTAAGTCCTTTTATATG 5'
5' ATGTTTGGGATTCAGGAAAATATAC 3'
   |||||||||||||||||||||||||
3' TACAAACCCTAAGTCCTTTTATATG 5'
5' ATGTTTGGGATTCAGGAAAATATAC 3'
   |||||||||||||||||||||||||
3' TACAAACCCTAAGTCCTTTTATATG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:17010558..17010582 25/25 Antisense target ebf3.L
Chr7S:13045426..13045450 25/25 Antisense target ebf3.S
Chr1S:59440907..59440931 22/25 Antisense off-target fabp2.S
Chr1S:189094919..189094943 22/25 Sense off-target LOC121399539
Chr3L:18361301..18361325 22/25 Antisense off-target LOC108710765
Chr3S:10864730..10864754 22/25 Antisense off-target LOC108712602
Chr1L:139459020..139459044 21/25 Antisense off-target kank1.L
Chr1L:58905183..58905207 21/25 Sense off-target fbxw7.L
Chr1S:111770270..111770294 21/25 Sense off-target mob3b.S
Chr1S:124038901..124038925 21/25 Antisense off-target frmd3.S
Chr4L:84770128..84770152 21/25 Sense off-target st3gal-iii
Chr2S:118102130..118102154 21/25 unknown
Chr2S:20877131..20877155 21/25 unknown
tropicalis 10.0 Chr7:22304971..22304995 25/25 Antisense target ebf3
Chr3:13561200..13561224 22/25 Antisense off-target ebf4
Chr6:74857928..74857952 21/25 Antisense off-target mocos
Chr3:64498724..64498748 21/25 Antisense off-target adamts20
Chr1:216293608..216293632 21/25 Antisense off-target LOC101730472
Chr1:216295920..216295944 21/25 Antisense off-target LOC101730472
Chr2:151446663..151446687 21/25 unknown
Chr4:44869896..44869920 21/25 unknown
Chr5:97380184..97380208 21/25 unknown
Publications
First: Absence of heartbeat in the Xenopus tropicalis mutation muzak is caused by a nonsense mutation in cardiac myosin myh6., Dev Biol 2009              
Most recent: EBF proteins participate in transcriptional regulation of Xenopus muscle development., Dev Biol 2011                      
View All Papers