Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249424

Morpholino Name: edil3 MO2
Synonyms: MO-A
Target mRNA: edil3

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTAGCAACAGATAAGCGGAGATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' GGATCCCTGTTTATCTGTTGCTAGC 3'
   ||||| | | |||||||||||||||
3' CCTAGAGGCGAATAGACAACGATCG 5'
5' GGATCTCCGCTTATCTGTTGCTAGC 3'
   |||||||||||||||||||||||||
3' CCTAGAGGCGAATAGACAACGATCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:196172960..196172984 25/25 Antisense target edil3.L
tropicalis 10.0 Chr1:180385661..180385685 22/25 Antisense target edil3
Publications
First: The secreted EGF-Discoidin factor xDel1 is essential for dorsal development of the Xenopus embryo., Dev Biol 2007                      
Most recent:
View All Papers