Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249427

Morpholino Name: ednra MO1
Synonyms: EdnraMO
Target mRNA: ednra

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAGGTGTTTCCTCCCATCCTGATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25 22/25
genome
MO
5' AATCAGGATGGGAGGCGACATCTTG 3'
    ||||||||||||||  ||| ||||
3' GTAGTCCTACCCTCCTTTGTGGAAC 5'
5' CATCAGGATGGGAGGAAACACCTTG 3'
   |||||||||||||||||||||||||
3' GTAGTCCTACCCTCCTTTGTGGAAC 5'
5' AATCAAGATGGGAGGAAACATCTTG 3'
    |||| |||||||||||||| ||||
3' GTAGTCCTACCCTCCTTTGTGGAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:61001787..61001811 25/25 Antisense target ednra.L
Chr1S:46392437..46392461 22/25 Antisense target ednra.S
Chr9_10S:73229569..73229593 21/25 Sense off-target LOC108703035
tropicalis 10.0 Chr1:57682860..57682884 21/25 Antisense target ednra
Publications
First: A new role for the Endothelin-1/Endothelin-A receptor signaling during early neural crest specification., Dev Biol 2008                            
Most recent: Gli2 is required for the induction and migration of Xenopus laevis neural crest., Mech Dev 2018                        
View All Papers