Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249428

Morpholino Name: eef1a2 MO1
Synonyms: MO-eEF1A2
Target mRNA: eef1a2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGTGTGTCTTCTCTTTCCCCATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GGATGGGGAAAGAGAAGACACACAT 3'
   |||||||||||||||||||||||||
3' CCTACCCCTTTCTCTTCTGTGTGTA 5'
5' GGATGGGGAAAGAGAAGACACACAT 3'
   |||||||||||||||||||||||||
3' CCTACCCCTTTCTCTTCTGTGTGTA 5'
5' GGATGGGGAAAGAGAAGACACACAT 3'
   |||||||||||||||||||||||||
3' CCTACCCCTTTCTCTTCTGTGTGTA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:17556978..17557002 25/25 Antisense target eef1a2.L
Chr9_10S:16784373..16784397 25/25 Antisense target eef1a2.S
Chr9_10L:27391574..27391598 21/25 Sense off-target aatk.L
Chr2S:159237311..159237335 21/25 Sense off-target LOC108710022
Chr3L:11002156..11002180 21/25 Sense off-target LOC121393056
tropicalis 10.0 Chr10:2002985..2003009 25/25 Antisense target eef1a2
Chr5:44007056..44007080 22/25 Antisense off-target igf2r
Chr7:25698098..25698122 21/25 Sense off-target ide
Chr1:201353843..201353867 21/25 Sense off-target lman1
Chr6:26763802..26763826 21/25 Antisense off-target spag6
Chr7:130122115..130122139 21/25 Sense off-target akr7a2
Chr3:135606341..135606365 21/25 unknown
Chr6:14636866..14636890 21/25 unknown
Chr6:14641198..14641222 21/25 unknown
Chr6:14654232..14654256 21/25 unknown
Chr6:14658647..14658671 21/25 unknown
Publications
First: Tumor suppressor p16(INK4a) inhibits cancer cell growth by downregulating eEF1A2 through a direct interaction., J Cell Sci 2013  
Most recent:
View All Papers