Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249429

Morpholino Name: efna1 MO1
Synonyms: Xephrin-A1 MO
Target mRNA: efna1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGCCGCTCTGTACAACTCCATCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' ATGATGGAGTTGTACAGAGCGGCGG 3'
   |||||||||||||||||||||||||
3' TACTACCTCAACATGTCTCGCCGCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:103337675..103337699 25/25 Antisense target efna1.S
tropicalis 10.0 Chr5:161875573..161875597 21/25 Sense off-target uckl1
Chr3:36967309..36967333 21/25 unknown
Publications
First: The involvement of Eph-Ephrin signaling in tissue separation and convergence during Xenopus gastrulation movements., Dev Biol 2011                            
Most recent:
View All Papers