Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249430

Morpholino Name: efnb1 MO1
Synonyms: ephrinB1 morpholino
Target mRNA: efnb1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGAGCCCTTCCATCCGCACAGGTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' CCACCTGTGCGGATGGAGGGGCTCC 3'
   ||||||||||||||||| |||||||
3' GGTGGACACGCCTACCTTCCCGAGG 5'
5' CCACCTGTGCGGATGGAAGGGCTCC 3'
   |||||||||||||||||||||||||
3' GGTGGACACGCCTACCTTCCCGAGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:33832341..33832365 25/25 Antisense target efnb1.L
tropicalis 10.0 Chr8:43381066..43381090 24/25 Antisense target efnb1
Chr9:15273360..15273384 21/25 Antisense off-target mprip
Publications
First: Morphogenetic movements underlying eye field formation require interactions between the FGF and ephrinB1 signaling pathways., Dev Cell 2004                  
Most recent: Polarized contact behavior in directionally migrating Xenopus gastrula mesendoderm., Int J Dev Biol 2023                
View All Papers