Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249431

Morpholino Name: efnb2 MO1
Synonyms: B2MO, ephrinB2
Target mRNA: efnb2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACACCGAGTCCCCGCTCAGTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGGCACTGAGCGGGGACTCGGTGT 3'
   |||||||||||||||||||||||||
3' TACCGTGACTCGCCCCTGAGCCACA 5'
5' ATGGCACTGAGCGGGGACTCGGTGT 3'
   |||||||||||||||||||||||||
3' TACCGTGACTCGCCCCTGAGCCACA 5'
5' ATGGCACTGAGCGGGGACTCGGTGT 3'
   |||||||||||||||||||||||||
3' TACCGTGACTCGCCCCTGAGCCACA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:123261530..123261554 25/25 Antisense target efnb2.L
Chr2S:109164887..109164911 25/25 Antisense target efnb2.S
tropicalis 10.0 Chr2:118479191..118479215 25/25 Antisense target efnb2
Publications
First: A molecular base for cell sorting at embryonic boundaries: contact inhibition of cadherin adhesion by ephrin/ Eph-dependent contractility., Dev Cell 2013  
Most recent: Eph/ephrin signaling controls cell contacts and formation of a structurally asymmetrical tissue boundary in the Xenopus gastrula., Dev Biol 2022                          
View All Papers