Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249435

Morpholino Name: egr1 MO2
Synonyms: XtEgr-1 MO2
Target mRNA: egr1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTTGGCACAGTGAGGGGAGACAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' CCTGTCTCCCCTCACTGTGCCAAGC 3'
   |||||||||||||||||||||||||
3' GGACAGAGGGGAGTGACACGGTTCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:141576315..141576339 21/25 Sense off-target otof.S
Chr8L:70984439..70984463 21/25 Sense off-target LOC108698634
Chr7S:74666895..74666919 21/25 unknown
tropicalis 10.0 Chr3:48248312..48248336 25/25 Antisense target egr1
Chr1:931994..932018 21/25 Antisense off-target idh3b
Chr5:145536205..145536229 21/25 Antisense off-target mfsd2b
Chr2:178676750..178676774 21/25 unknown
Chr2:178676950..178676974 21/25 unknown
Chr2:120806048..120806072 21/25 unknown
Publications
First: Downstream of FGF during mesoderm formation in Xenopus: the roles of Elk-1 and Egr-1., Dev Biol 2009            
Most recent:
View All Papers