Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249436

Morpholino Name: eif4a3.1 MO1
Synonyms: 4a3MO, Eif4a3MO, eif4a3 MO1
Target mRNA: eif4a3.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCCGCCATTTTCCCTTAGCGAATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 24/25
genome
MO
5' CATTCGCTAAGGGAAAATGGCGGCC 3'
   |||||||||||||||||||||||||
3' GTAAGCGATTCCCTTTTACCGCCGG 5'
5' CATTCGATAAGGGAAAATGGCGGCC 3'
   |||||| ||||||||||||||||||
3' GTAAGCGATTCCCTTTTACCGCCGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:30469229..30469253 24/25 Antisense target eif4a3.1.S
Chr5S:30439867..30439891 25/25 Antisense off-target LOC121393038
Chr2S:133761640..133761664 21/25 unknown
tropicalis 10.0 Chr5:38846797..38846821 25/25 Antisense target eif4a3.1
Publications
First: Regulation of vertebrate embryogenesis by the exon junction complex core component Eif4a3., Dev Dyn 2010                
Most recent: Eif4a3 is required for accurate splicing of the Xenopus laevis ryanodine receptor pre-mRNA., Dev Biol 2012              
View All Papers